View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0864_high_29 (Length: 251)
Name: NF0864_high_29
Description: NF0864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0864_high_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 6 - 138
Target Start/End: Complemental strand, 24583284 - 24583152
Alignment:
Q |
6 |
ttccatgattttcttttaatttctatcaaatattaggatagatttcttacaaatttataatttatcctgataattattaatttctatcttaatatttctt |
105 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24583284 |
ttccatgattttcttttaatttctatcaaatattatgatggatttcttacaaatttataatttatcctgataattattaatttctatcttaatatttctt |
24583185 |
T |
 |
Q |
106 |
acaaatagaagggtgcgcaaaaatgactaggat |
138 |
Q |
|
|
|||||||| ||||||||||||||||| |||||| |
|
|
T |
24583184 |
acaaatagtagggtgcgcaaaaatgagtaggat |
24583152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 159 - 213
Target Start/End: Complemental strand, 24583131 - 24583077
Alignment:
Q |
159 |
tatatgtttttccctcatctgaattagttctacttgcacattctacgatccattt |
213 |
Q |
|
|
|||||| |||| ||||||||||||||| |||||||||||||||||| ||||||| |
|
|
T |
24583131 |
tatatgctttttcctcatctgaattaggtctacttgcacattctacagtccattt |
24583077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1147 times since January 2019
Visitors: 6137