View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0864_low_10 (Length: 353)
Name: NF0864_low_10
Description: NF0864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0864_low_10 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 22 - 353
Target Start/End: Original strand, 12956412 - 12956743
Alignment:
Q |
22 |
atcatccaatgcctagtattccttcaccacatggaaatggccctccccttttaccttctccaacctctcaatttctcttgccttctccaactggttacat |
121 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12956412 |
atcatccaatgcctagtattccttcaccgcatggaaatggccctccccttttaccttctccaacctctcaatttctcttgccttctccaactggttacat |
12956511 |
T |
 |
Q |
122 |
gaatttactgtcccctcggtcaccttatccactattgtcacccggctttcagtttccatcaccactacccaatttttcgttctcacccatggcacagtca |
221 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
T |
12956512 |
gaatttactgtcccctcggtcaccttatccactattgtcacccggctttcagtttccatcaccactacccaattttccgttctcacccatgggacagtca |
12956611 |
T |
 |
Q |
222 |
ggaattttagggcctggccctcaaccaccaccttctcccggccttatgtttccattatctccttcaagcttcttcaccatgccaagtcctaggtggagag |
321 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12956612 |
ggaattttagggcctggccctcaaccaccaccttctcccggccttatgtttccattatctccttcaagcttcttcaccatgccaagtcctaggtggagag |
12956711 |
T |
 |
Q |
322 |
atcaatagtcttctcaaattgtgcatacatgt |
353 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
12956712 |
atcaatagtcttctcaaattgtgcatacatgt |
12956743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University