View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0864_low_12 (Length: 340)

Name: NF0864_low_12
Description: NF0864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0864_low_12
NF0864_low_12
[»] chr3 (2 HSPs)
chr3 (29-253)||(43702583-43702807)
chr3 (278-312)||(43702544-43702578)


Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 29 - 253
Target Start/End: Complemental strand, 43702807 - 43702583
Alignment:
29 cctgttatggatgcggactttgaaccgggtttagcgtggatggttatagcgacggatgaaggaggcatgcagcgaatacaagacggaatattgttaggtt 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43702807 cctgttatggatgcggactttgaaccgggtttagcgtggatggttatagcgacggatgaaggaggcatgcagcgaatacaagacggaatattgttaggtt 43702708  T
129 tttccgaaggaaccgtttcctttggttctgcctttgcttttcccttcttcgccggcgccattttttcaattttccgacaatcgatgccggagacttgcgt 228  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
43702707 tttccgaaggaaccgtttcctttggttctgcctttgcttttcccttcttcgccggcgccattttttcaattttccgacgatcgatgccggagacttgcgt 43702608  T
229 acttcaaacgctgtcgttttcgatc 253  Q
    |||||||||||||||||||||||||    
43702607 acttcaaacgctgtcgttttcgatc 43702583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 278 - 312
Target Start/End: Complemental strand, 43702578 - 43702544
Alignment:
278 gctttttgcattgtgttatgcgggggtatggaatt 312  Q
    |||||||||||||||||||||||||||||||||||    
43702578 gctttttgcattgtgttatgcgggggtatggaatt 43702544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University