View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0864_low_16 (Length: 329)
Name: NF0864_low_16
Description: NF0864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0864_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 97 - 315
Target Start/End: Complemental strand, 18189169 - 18188951
Alignment:
| Q |
97 |
ccagaaccttctccgacctcacaaattgaattgttcccctcattcaagttaacatccccagcatttggagcaacttgagtttcaacattctcctcaggga |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18189169 |
ccagaaccttctccgacctcacaaattgaattgttcccctcattcaagttaacatccccagcatttggagcaacttgagtttcaacattctcctcaggga |
18189070 |
T |
|
| Q |
197 |
ccgagttttcgtccattggaatttctctgcaagaatcagcatccgcattcacttgctcaccacccacaacattttctcgaggcagagaatcttcttcaaa |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
18189069 |
ccgagttttcgtccattggaatttctctgcaagaatcagcatccgcattcacttgctcaccacccacaacattttctcgaggcagagaatcttcttgaaa |
18188970 |
T |
|
| Q |
297 |
ccctaatttcaatttcttt |
315 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
18188969 |
ccctaatttcaatttcttt |
18188951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 97 - 185
Target Start/End: Complemental strand, 18189274 - 18189186
Alignment:
| Q |
97 |
ccagaaccttctccgacctcacaaattgaattgttcccctcattcaagttaacatccccagcatttggagcaacttgagtttcaacatt |
185 |
Q |
| |
|
|||||||||||||||||||||||| |||| | ||||||||| ||| ||||||| |||| ||| | || |||||||||||||| |||| |
|
|
| T |
18189274 |
ccagaaccttctccgacctcacaacttgatctattcccctcaaccaatttaacattcccaccatcttgaacaacttgagtttcagcatt |
18189186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 179 - 234
Target Start/End: Complemental strand, 52895044 - 52894989
Alignment:
| Q |
179 |
caacattctcctcagggaccgagttttcgtccattggaatttctctgcaagaatca |
234 |
Q |
| |
|
||||||| ||||| |||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
52895044 |
caacattttcctcttggacagggttttcgtccattggaatttctctgcaagaatca |
52894989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1162 times since January 2019
Visitors: 6137