View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0864_low_20 (Length: 321)

Name: NF0864_low_20
Description: NF0864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0864_low_20
NF0864_low_20
[»] chr7 (1 HSPs)
chr7 (107-228)||(32502211-32502332)


Alignment Details
Target: chr7 (Bit Score: 114; Significance: 8e-58; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 107 - 228
Target Start/End: Original strand, 32502211 - 32502332
Alignment:
107 actgttgtcctagttaacacagttgcaaaatgaattataacctagttgaaaatgaattttaatctggctgcagtttactgtaacaaagacaaactaaatt 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
32502211 actgttgtcctagttaacacagttgcaaaatgaattataacctagttgaaaatgaattttaatccggctgcagtttactgtaacaaagacaaactaaatt 32502310  T
207 tgttttggattaatgatgatgt 228  Q
    ||||||||||||||||| ||||    
32502311 tgttttggattaatgataatgt 32502332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University