View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0864_low_20 (Length: 321)
Name: NF0864_low_20
Description: NF0864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0864_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 8e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 107 - 228
Target Start/End: Original strand, 32502211 - 32502332
Alignment:
Q |
107 |
actgttgtcctagttaacacagttgcaaaatgaattataacctagttgaaaatgaattttaatctggctgcagtttactgtaacaaagacaaactaaatt |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
32502211 |
actgttgtcctagttaacacagttgcaaaatgaattataacctagttgaaaatgaattttaatccggctgcagtttactgtaacaaagacaaactaaatt |
32502310 |
T |
 |
Q |
207 |
tgttttggattaatgatgatgt |
228 |
Q |
|
|
||||||||||||||||| |||| |
|
|
T |
32502311 |
tgttttggattaatgataatgt |
32502332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University