View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0864_low_23 (Length: 285)

Name: NF0864_low_23
Description: NF0864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0864_low_23
NF0864_low_23
[»] chr5 (1 HSPs)
chr5 (36-222)||(23220105-23220285)


Alignment Details
Target: chr5 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 36 - 222
Target Start/End: Complemental strand, 23220285 - 23220105
Alignment:
36 atgaaaatgggtgcagcatttttgtttatttctttgaggttgaaatttggagtgtggtcgttataaccaatggttcattcaaatgcagcattttgaaatt 135  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |    
23220285 atgaaaatgggtgcaacatttttgtttatttctttgaggttgaaatttggagtgtgggcgttataaccaatggttcatccaaatgcagcattttgaaaat 23220186  T
136 aagtataaattattgaaattaagttatgctcctagattttaccatccaactaactaaagttcgctgtgccatccaaactgtgcattt 222  Q
         |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
23220185 -----taaattattgaaattaagttatgctcctagattttaccatccaactaact-aagttcgctgtgccatccaaactgtgcattt 23220105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 480 times since January 2019
Visitors: 6128