View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0864_low_24 (Length: 285)

Name: NF0864_low_24
Description: NF0864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0864_low_24
NF0864_low_24
[»] chr6 (1 HSPs)
chr6 (27-274)||(6955686-6955939)
[»] chr8 (1 HSPs)
chr8 (27-182)||(22454767-22454922)


Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 27 - 274
Target Start/End: Original strand, 6955686 - 6955939
Alignment:
27 tcatcttgaatatcagcgattccaaaaatatctccttgtgaaaaacgaagttcaagatttgtccaaacagaggagactttgtcgatccataaaatggatt 126  Q
    ||||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||    
6955686 tcatcttgaatatcagcaattcaaaaaatatccccttgtgaaaaacgaagttcaagatttggccaaacagaagagactttgtcgatccataaaatggatt 6955785  T
127 tagaaatactttcagaaattgagcgttgaagccatgagagaaccatgttgttgcagcggatccatggctcgtgcaagacattcgtagatgaaggacattg 226  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6955786 tagaaatactttcagaaattgagcgttgaagccatgagagaaccatgttgttgcagcggatccatggctcgtgcaagacattcgtagatgaaggacattg 6955885  T
227 aaaagtgccgtc------tcgaagcttgttcttagaaattagggctaccttcat 274  Q
    |||| |||||||      ||||||||||||||||||||||||||||||||||||    
6955886 aaaactgccgtcgataaatcgaagcttgttcttagaaattagggctaccttcat 6955939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 27 - 182
Target Start/End: Complemental strand, 22454922 - 22454767
Alignment:
27 tcatcttgaatatcagcgattccaaaaatatctccttgtgaaaaacgaagttcaagatttgtccaaacagaggagactttgtcgatccataaaatggatt 126  Q
    |||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
22454922 tcatcttgaatatcagcgattcaaaaaatatccccttgtgaaaaacgaagttcaagatttgtccaaacagaggaggctttgtcgatccataaaatggatt 22454823  T
127 tagaaatactttcagaaattgagcgttgaagccatgagagaaccatgttgttgcag 182  Q
    |||||||||||||| ||||||||| |||||||||||||||||||||||||||||||    
22454822 tagaaatactttcaaaaattgagcattgaagccatgagagaaccatgttgttgcag 22454767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 263 times since January 2019
Visitors: 6127