View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0864_low_24 (Length: 285)
Name: NF0864_low_24
Description: NF0864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0864_low_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 27 - 274
Target Start/End: Original strand, 6955686 - 6955939
Alignment:
Q |
27 |
tcatcttgaatatcagcgattccaaaaatatctccttgtgaaaaacgaagttcaagatttgtccaaacagaggagactttgtcgatccataaaatggatt |
126 |
Q |
|
|
||||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
T |
6955686 |
tcatcttgaatatcagcaattcaaaaaatatccccttgtgaaaaacgaagttcaagatttggccaaacagaagagactttgtcgatccataaaatggatt |
6955785 |
T |
 |
Q |
127 |
tagaaatactttcagaaattgagcgttgaagccatgagagaaccatgttgttgcagcggatccatggctcgtgcaagacattcgtagatgaaggacattg |
226 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6955786 |
tagaaatactttcagaaattgagcgttgaagccatgagagaaccatgttgttgcagcggatccatggctcgtgcaagacattcgtagatgaaggacattg |
6955885 |
T |
 |
Q |
227 |
aaaagtgccgtc------tcgaagcttgttcttagaaattagggctaccttcat |
274 |
Q |
|
|
|||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
6955886 |
aaaactgccgtcgataaatcgaagcttgttcttagaaattagggctaccttcat |
6955939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 27 - 182
Target Start/End: Complemental strand, 22454922 - 22454767
Alignment:
Q |
27 |
tcatcttgaatatcagcgattccaaaaatatctccttgtgaaaaacgaagttcaagatttgtccaaacagaggagactttgtcgatccataaaatggatt |
126 |
Q |
|
|
|||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
22454922 |
tcatcttgaatatcagcgattcaaaaaatatccccttgtgaaaaacgaagttcaagatttgtccaaacagaggaggctttgtcgatccataaaatggatt |
22454823 |
T |
 |
Q |
127 |
tagaaatactttcagaaattgagcgttgaagccatgagagaaccatgttgttgcag |
182 |
Q |
|
|
|||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
22454822 |
tagaaatactttcaaaaattgagcattgaagccatgagagaaccatgttgttgcag |
22454767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University