View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0864_low_25 (Length: 284)
Name: NF0864_low_25
Description: NF0864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0864_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 32 - 221
Target Start/End: Complemental strand, 23220288 - 23220105
Alignment:
Q |
32 |
gaaaagaaaatgggtgcagcatttttgtttatttctttgaggttgaaatttggagtgtggtcgttataaccaatggttcattcaaatgcagcattttgaa |
131 |
Q |
|
|
|||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
T |
23220288 |
gaaatgaaaatgggtgcaacatttttgtttatttctttgaggttgaaatttggagtgtgggcgttataaccaatggttcatccaaatgcagcattttgaa |
23220189 |
T |
 |
Q |
132 |
attaagtataaattattgaaattaagttatgctcctagattttaccatccaactaactaaagttcgctgtgccatccaaactgtgcattt |
221 |
Q |
|
|
| | |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
23220188 |
aat-----taaattattgaaattaagttatgctcctagattttaccatccaactaact-aagttcgctgtgccatccaaactgtgcattt |
23220105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 254 times since January 2019
Visitors: 6127