View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0864_low_25 (Length: 284)

Name: NF0864_low_25
Description: NF0864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0864_low_25
NF0864_low_25
[»] chr5 (1 HSPs)
chr5 (32-221)||(23220105-23220288)


Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 32 - 221
Target Start/End: Complemental strand, 23220288 - 23220105
Alignment:
32 gaaaagaaaatgggtgcagcatttttgtttatttctttgaggttgaaatttggagtgtggtcgttataaccaatggttcattcaaatgcagcattttgaa 131  Q
    |||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||    
23220288 gaaatgaaaatgggtgcaacatttttgtttatttctttgaggttgaaatttggagtgtgggcgttataaccaatggttcatccaaatgcagcattttgaa 23220189  T
132 attaagtataaattattgaaattaagttatgctcctagattttaccatccaactaactaaagttcgctgtgccatccaaactgtgcattt 221  Q
    | |     |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
23220188 aat-----taaattattgaaattaagttatgctcctagattttaccatccaactaact-aagttcgctgtgccatccaaactgtgcattt 23220105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 254 times since January 2019
Visitors: 6127