View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0864_low_30 (Length: 268)
Name: NF0864_low_30
Description: NF0864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0864_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 7949510 - 7949248
Alignment:
| Q |
1 |
cctttccttcaattgtaattagaggggacctaggtaggaacaagctaggtcttcccaactttcgattttgttaatgttcctttgatggtttggttttgcc |
100 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7949510 |
cctttcctccaattataattagaggggacctaggtaggaataagctaggtcttcccaactttcgattttgttaatgttcctttgagggtttggttttgcc |
7949411 |
T |
 |
| Q |
101 |
-ccctctcttttgtgttacactttttcatttatatattatagatgtcgcct-taggctcgtcaattat--------nnnnnnnnnnnttattttacaaaa |
190 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||||||| |||||| ||| |||| ||||| ||||||| |
|
|
| T |
7949410 |
accctctcttttgtattacaatttttcatttatatattatagatgtcgcctcaaggctcatcagttataaaaataaaataaaataaattattatacaaaa |
7949311 |
T |
 |
| Q |
191 |
taaagtgacaaccatgccaagacacttacaagttccaacccccgcatttgaaaccgtctctcc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
7949310 |
taaagtgacaaccatgccaagacacttacaagttccaacccccacatttgaagccgtctctcc |
7949248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University