View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0864_low_41 (Length: 251)
Name: NF0864_low_41
Description: NF0864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0864_low_41 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 28990634 - 28990507
Alignment:
| Q |
1 |
ccctaggtttgtagttgagtttagttaattgtacattctttttgggtagaaatttttcggatttgaaactttgaatcatgaacaataacaatagagggag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28990634 |
ccctaggtttgtagttgagtttagttaattgtacattctttttgggtagaaatttttcggatttgaaactttgaatcatgaacaataacaatagagggag |
28990535 |
T |
|
| Q |
101 |
atatccacctgggattgggttaggacga |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
28990534 |
atatccacctgggattgggttaggacga |
28990507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 29001073 - 29000946
Alignment:
| Q |
1 |
ccctaggtttgtagttgagtttagttaattgtacattctttttgggtagaaatttttcggatttgaaactttgaatcatgaacaataacaatagagggag |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29001073 |
ccctaggtttgtagttgagtttagttgattgtacattctttttgggtagaatttttttggatttgaaactttgaatcatgaacaataacaatagagggag |
29000974 |
T |
|
| Q |
101 |
atatccacctgggattgggttaggacga |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
29000973 |
atatccacctgggattgggttaggacga |
29000946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 2 - 128
Target Start/End: Complemental strand, 28977103 - 28976977
Alignment:
| Q |
2 |
cctaggtttgtagttgagtttagttaattgtacattctttttgggtagaaatttttcggatttgaaactttgaatcatgaacaataacaatagagggaga |
101 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28977103 |
cctaggtttgtagttgagtttagtttattgtacattatttttgggttgaaattttttggatttgaaacttcgaatcatgaacaataacaatagagggaga |
28977004 |
T |
|
| Q |
102 |
tatccacctgggattgggttaggacga |
128 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
28977003 |
tatccacctgggattgggttaggacga |
28976977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 159 - 222
Target Start/End: Complemental strand, 28990470 - 28990407
Alignment:
| Q |
159 |
ttgaactcaaacccgaacaatgcgaacgctgggtttcaacagagaccacattatcaacaacaac |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28990470 |
ttgaactcaaacccgaacaatgcgaacgccgggtttcaacagagaccacattatcaacaacaac |
28990407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 159 - 222
Target Start/End: Complemental strand, 29000927 - 29000864
Alignment:
| Q |
159 |
ttgaactcaaacccgaacaatgcgaacgctgggtttcaacagagaccacattatcaacaacaac |
222 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29000927 |
ttgaactcaaacccgaacaatgcaaacgccgggtttcaacagagaccacattatcaacaacaac |
29000864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 389 times since January 2019
Visitors: 6128