View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0864_low_45 (Length: 249)
Name: NF0864_low_45
Description: NF0864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0864_low_45 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 41406836 - 41406600
Alignment:
| Q |
1 |
tgaaagacatcggcgccgcgaacggggaacccatcacgcatccaactacgaaatgcggaggctatggattctcctttgggaagcttttcgattctcttac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41406836 |
tgaaagacatcggcgccgcgaacggggaagccatcacgcatccaactacgaaatgcggaggctatggattctcctttgggaagcttttcgattctcttac |
41406737 |
T |
|
| Q |
101 |
acaagctatcttggttttgagttgtttgtgtgcaaaagaatttaaaacagagatgggtttcaatgagacaaggtgttcgacgtattgtctctatgaactt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
41406736 |
acaagctatcttggttttgagttgtttgtgtgcaaaagaatttaaaacagagatgggtttcaatgacagaaggtgttcgacgtattgtctctatgaactt |
41406637 |
T |
|
| Q |
201 |
cgcgtatattgcgatgctcattagatttcgcatgctc |
237 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41406636 |
cgcgtatattgcgatgctcattagttttcgcatgctc |
41406600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2464 times since January 2019
Visitors: 6164