View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0864_low_49 (Length: 222)
Name: NF0864_low_49
Description: NF0864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0864_low_49 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 25678592 - 25678400
Alignment:
| Q |
1 |
ataatttacttttaaaaatgtaacctcaagggtttaaacttcaaatcctcgaggacagttgaaaaatgactattattgtcttagaattgaagatttannn |
100 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25678592 |
ataatttacatttaaaattgtaacctcaagggtttaaacttcaaatccttgagggcagttgaaaaatgactattattgtcttagaattgaagatttattt |
25678493 |
T |
|
| Q |
101 |
nnnnnnnnnnnnnnacagatgtggatcatatggggatgcttctcttgccatgtatgaaaacatggtgcaaatgagttcaataagtgactctag |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25678492 |
ttctttttctttttacagatgtggatcatatggggatgcttctcttgccatgtatgaaaacatggtgcaaatgagttcaataagtgactctag |
25678400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2057 times since January 2019
Visitors: 6156