View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0864_low_50 (Length: 219)

Name: NF0864_low_50
Description: NF0864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0864_low_50
NF0864_low_50
[»] chr4 (2 HSPs)
chr4 (1-117)||(4119608-4119724)
chr4 (160-193)||(4119739-4119772)


Alignment Details
Target: chr4 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 4119608 - 4119724
Alignment:
1 gcttgagcttcatagttaatacatgttcataatagccataaacaagataaaaccatcacggtagcttgctcaaagtcacaaaataataacctaccaagga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4119608 gcttgagcttcatagttaatacatgttcataatagccataaacaagataaaaccatcacggtagcttgctcaaagtcacaaaataataacctaccaagga 4119707  T
101 taaaatcatcacttcat 117  Q
    |||||||||||||||||    
4119708 taaaatcatcacttcat 4119724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 160 - 193
Target Start/End: Original strand, 4119739 - 4119772
Alignment:
160 aaaaatatcttccattttgtatcaccagaataat 193  Q
    ||||||||||||||||||||||||||||||||||    
4119739 aaaaatatcttccattttgtatcaccagaataat 4119772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 836 times since January 2019
Visitors: 6131