View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0864_low_51 (Length: 201)
Name: NF0864_low_51
Description: NF0864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0864_low_51 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 172
Target Start/End: Complemental strand, 37816992 - 37816821
Alignment:
| Q |
1 |
tatgacaatacttcgaaaaagannnnnnnaacaaatacttcgaataggattatcaccaatgttgagagtttatgtaaaatatattaaaattgataatgta |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37816992 |
tatgacaatacttcgaaaaagatttttttaacaaatacttcgaataggattatcaccaatgttgagagtttatgtaaaatatattaaaattgataatgta |
37816893 |
T |
|
| Q |
101 |
attaatgtgtatattttgtacgaggatctgagtttaaattctgatgaaagtgaaaatgttaatataaatgag |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37816892 |
attaatgtgtatattttgtacgaggatctgagttcaaattctgatgaaagtgaaaatgttaatataaatgag |
37816821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1183 times since January 2019
Visitors: 6137