View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0865_high_12 (Length: 318)

Name: NF0865_high_12
Description: NF0865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0865_high_12
NF0865_high_12
[»] chr1 (2 HSPs)
chr1 (161-228)||(3109554-3109621)
chr1 (54-98)||(3109443-3109487)


Alignment Details
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 161 - 228
Target Start/End: Original strand, 3109554 - 3109621
Alignment:
161 ggtgtagtgaagttgaagtgcagagggattaacccaaatgaccatgcctttaaatctgagcttgtaag 228  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3109554 ggtgtagtgaagttgaagtgcagagggattaacccaaatgaccatgcctttaaatctgagcttgtaag 3109621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 54 - 98
Target Start/End: Original strand, 3109443 - 3109487
Alignment:
54 cgtatttcaatgcaacccatcaatgtttttcttcaaaaattccaa 98  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
3109443 cgtatttcaatgcaacccatcaatgtttttcttcaaaaattccaa 3109487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University