View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0865_high_21 (Length: 297)
Name: NF0865_high_21
Description: NF0865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0865_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 98 - 238
Target Start/End: Original strand, 2564130 - 2564270
Alignment:
Q |
98 |
ttgggttgaaaaatgaacaaattgtgggcaacacatgtatacctacctagtggttagttgcccagtcgagaaagatatatcttttcttgggaccacgggc |
197 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2564130 |
ttggtttgaaaaatgaacaaattgtgggcaacacatgtatacctacctagtggttagttgcccagtcgagaaagatatatcttttcttgggaccacgggc |
2564229 |
T |
 |
Q |
198 |
aatgatttgtgaggctagtgcacaatgcacatgggtttgta |
238 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2564230 |
aatgatttgtgaggctagtgcacaatgcacatgggtttgta |
2564270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 7 - 106
Target Start/End: Complemental strand, 8773857 - 8773758
Alignment:
Q |
7 |
gatcaatctctctcattccgtttactgcatttaatgattcacagaaaagattgttgctttcttctttcctctaatgtttctgttagccttgttgggttga |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8773857 |
gatcaatctctctcattccgtttactgcatttaatgattcacagaaaagattgttgctttcttctttcctctaatgtttctgttagccttgttgggttga |
8773758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3184 times since January 2019
Visitors: 6172