View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0865_high_26 (Length: 273)
Name: NF0865_high_26
Description: NF0865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0865_high_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 34 - 220
Target Start/End: Original strand, 45143309 - 45143489
Alignment:
| Q |
34 |
atgaaaaagggaagctagctatttactcaaagcatgatttgacttattttcacccctgtttatgtaccacatattgtattgtatgtattgaagactagca |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45143309 |
atgaaaaagggaagctagctatttactcaaagcatgatttgacttattttcacccctgtttatgtaccaca-----tattgtatgtattgaagactagca |
45143403 |
T |
|
| Q |
134 |
ttcaaaggcctagttccacaagaacagcctagtgtgtacaggagagnnnnnnnntctaatagtcatcatatcatatgatggagatag |
220 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45143404 |
ttcaaagg-ctagttccacaagaacagcctagtgtgtacaggagagaaaaaaaatctaatagtcatcatatcatatgatggagatag |
45143489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 776 times since January 2019
Visitors: 6131