View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0865_high_31 (Length: 245)

Name: NF0865_high_31
Description: NF0865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0865_high_31
NF0865_high_31
[»] chr4 (1 HSPs)
chr4 (1-218)||(3324662-3324882)


Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 3324662 - 3324882
Alignment:
1 attaaaaatcacaattttagttactggttagtgatgtattgtaccattttgaatagaacttaggcttcaataaccatcgaaacatttgtatcatagaata 100  Q
    ||||||||||||||||||||||| ||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3324662 attaaaaatcacaattttagttattggttagtgttatattgtaccattttgaatagaacttaggcttcaataaccatcgaaacatttgtatcatagaata 3324761  T
101 tatgaggagaccctattggctaaaaagggaaatgtcttttcttgttgatgttggatattttagaggatatgttggggtaaatta---aatatagatgtag 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||    
3324762 tatgaggagaccctattggctaaaaagggaaatgtcttttcttgttgatgttggatattttagaggatatgttggggtaaattaaataatatagatgtag 3324861  T
198 tgtatttagaatgattgaaca 218  Q
    |||||||||||||||||||||    
3324862 tgtatttagaatgattgaaca 3324882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1820 times since January 2019
Visitors: 6150