View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0865_high_31 (Length: 245)
Name: NF0865_high_31
Description: NF0865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0865_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 3324662 - 3324882
Alignment:
Q |
1 |
attaaaaatcacaattttagttactggttagtgatgtattgtaccattttgaatagaacttaggcttcaataaccatcgaaacatttgtatcatagaata |
100 |
Q |
|
|
||||||||||||||||||||||| ||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3324662 |
attaaaaatcacaattttagttattggttagtgttatattgtaccattttgaatagaacttaggcttcaataaccatcgaaacatttgtatcatagaata |
3324761 |
T |
 |
Q |
101 |
tatgaggagaccctattggctaaaaagggaaatgtcttttcttgttgatgttggatattttagaggatatgttggggtaaatta---aatatagatgtag |
197 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
3324762 |
tatgaggagaccctattggctaaaaagggaaatgtcttttcttgttgatgttggatattttagaggatatgttggggtaaattaaataatatagatgtag |
3324861 |
T |
 |
Q |
198 |
tgtatttagaatgattgaaca |
218 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
3324862 |
tgtatttagaatgattgaaca |
3324882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1820 times since January 2019
Visitors: 6150