View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0865_high_33 (Length: 225)
Name: NF0865_high_33
Description: NF0865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0865_high_33 |
 |  |
|
[»] scaffold0070 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 73 - 202
Target Start/End: Original strand, 7247255 - 7247384
Alignment:
Q |
73 |
ctgcacctgcctttgttgttgctgctgctgcccttgtctctgacatcttttacagaaattcataaactaatgtacaaagaaaaaattaaattcaaatgca |
172 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
7247255 |
ctgcacctgcctttgttgttgctgctgctgcccttgtctctgacatcttttacacaaattcataaactaatgtacaaagaaaaaattaaatgcaaatgca |
7247354 |
T |
 |
Q |
173 |
tgttagtccatgcacctttggttttgctgt |
202 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
7247355 |
tgttagtccatgcacctttggttttgctgt |
7247384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 42805645 - 42805584
Alignment:
Q |
1 |
cacatctaactaaattttcaaactaatatataatatcatgagatgaagacagacacaggttc |
62 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
T |
42805645 |
cacatctaactaaattttcaaactgatatataatatcatgagatgaagacagacacaagttc |
42805584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 98 - 193
Target Start/End: Complemental strand, 25321474 - 25321379
Alignment:
Q |
98 |
tgctgcccttgtctctgacatcttttacagaaattcataaactaatgtacaaagaaaaaattaaattcaaatgcatgttagtccatgcacctttgg |
193 |
Q |
|
|
||||||| |||||||| |||||||||||| ||||||| || |||||||||| ||||| | || |||||||||||||| |||||| ||||||||| |
|
|
T |
25321474 |
tgctgcctttgtctctaacatcttttacaaaaattcactaataaatgtacaaataaaaactaaatttcaaatgcatgttggtccattcacctttgg |
25321379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 98 - 193
Target Start/End: Original strand, 18409 - 18505
Alignment:
Q |
98 |
tgctgcccttgtctctgacatctttt-acagaaattcataaactaatgtacaaagaaaaaattaaattcaaatgcatgttagtccatgcacctttgg |
193 |
Q |
|
|
||||||| ||||| |||||||||||| ||| ||||||| || |||||||||||||||| | || |||||||||||||| |||||| ||||||||| |
|
|
T |
18409 |
tgctgcctttgtcactgacatctttttacaaaaattcacaaggaaatgtacaaagaaaaactaaatttcaaatgcatgttggtccattcacctttgg |
18505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University