View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0865_low_21 (Length: 318)
Name: NF0865_low_21
Description: NF0865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0865_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 55 - 314
Target Start/End: Original strand, 45627220 - 45627492
Alignment:
Q |
55 |
gtatagtctatataaaaatgaaataaaataatctttatttttcgtggattagatttaactttttgtttatatgaatgaatatgaatgaattt-------- |
146 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
45627220 |
gtataatctatataaaaatgaaataaaataatctttattttttgtggattagatttaactttttgtttatatgaatgaatatcaatgaatttagaaattt |
45627319 |
T |
 |
Q |
147 |
ggaaataatgcacgcaaatacgtagcaatagcatagca-----tagagacgtgcgcccctaaagtgacttttaatactgtattttgtatctttttgcttt |
241 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45627320 |
ggaaataatgcacacaaatacgtagcaatagcatagcaaagcatagagacgtgcacccctaaagtgacttttaatactgtattttgtatctttttgcttt |
45627419 |
T |
 |
Q |
242 |
gtctactttttctgaaaagatacttattcgtaataaaagacgtcagcaaggacgtcattatcaaatcttaatg |
314 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45627420 |
gtctactttttctgaaaagatacttattcgtaataaaagacgtcagcaaggacgtcattatcaaatcttaatg |
45627492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2239 times since January 2019
Visitors: 6160