View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0865_low_22 (Length: 318)
Name: NF0865_low_22
Description: NF0865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0865_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 161 - 228
Target Start/End: Original strand, 3109554 - 3109621
Alignment:
Q |
161 |
ggtgtagtgaagttgaagtgcagagggattaacccaaatgaccatgcctttaaatctgagcttgtaag |
228 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3109554 |
ggtgtagtgaagttgaagtgcagagggattaacccaaatgaccatgcctttaaatctgagcttgtaag |
3109621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 54 - 98
Target Start/End: Original strand, 3109443 - 3109487
Alignment:
Q |
54 |
cgtatttcaatgcaacccatcaatgtttttcttcaaaaattccaa |
98 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3109443 |
cgtatttcaatgcaacccatcaatgtttttcttcaaaaattccaa |
3109487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1488 times since January 2019
Visitors: 6143