View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0865_low_28 (Length: 305)

Name: NF0865_low_28
Description: NF0865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0865_low_28
NF0865_low_28
[»] chr4 (1 HSPs)
chr4 (51-234)||(54266002-54266185)


Alignment Details
Target: chr4 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 51 - 234
Target Start/End: Complemental strand, 54266185 - 54266002
Alignment:
51 ataatactcatgctttcttttttacaagtatatactatatattgctactaattgtaagtatattacataaatgagtaaaacaatcatttttgtttttaaa 150  Q
    |||||| ||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
54266185 ataatattcatgctttcttttttacaagtatataatatatattgctactaatagtaagtatattacataaatgagtaaaacaatcatttttgtttttaaa 54266086  T
151 atgtgaggtatagatgtgtttattgttaattttacatataacttgtgtcagtgtagtgtgttctgctctacatgctttggatta 234  Q
    |||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
54266085 atgtgaggtatatatgtgtttattgttaattttacatataacttgcgtcagtgtagtgtgttctgctctacatgctttggatta 54266002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1579 times since January 2019
Visitors: 6145