View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0865_low_36 (Length: 292)
Name: NF0865_low_36
Description: NF0865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0865_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 30 - 284
Target Start/End: Complemental strand, 21549578 - 21549324
Alignment:
Q |
30 |
aagtactcttctacaagaatatatcaagagcttgaacttagacaaaaatcccccaaaagagtatacaagaaaatcttcaactaaagccagtgacagtgag |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
21549578 |
aagtactcttctacaagaatatatcaagagcttgaacttagacaaaaatcccccaaaagagtatacaagaaaatcttcaactaaagccagtgacagtgag |
21549479 |
T |
 |
Q |
130 |
tgtttgctaaccaaccaaagcacagtatcagctcagtctcagaaaggcagtgacagtgagtgtttgctatcaagcggtgattttgacgatgatatcctaa |
229 |
Q |
|
|
| |||||||||||||||||||||| ||||||||||||||||||||| || ||||||| |||||||||||||||||||||||||||| || ||||||||| |
|
|
T |
21549478 |
tatttgctaaccaaccaaagcacaatatcagctcagtctcagaaagccaatgacagtcagtgtttgctatcaagcggtgattttgaagacgatatcctag |
21549379 |
T |
 |
Q |
230 |
atatttgtttcgatgataatatgtttcaagatgggtgtaatactgattctctgct |
284 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||| || |||||||||||| |
|
|
T |
21549378 |
atatttgtttcgatgataatttgtttcaagatgggtgtagtattgattctctgct |
21549324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 34 - 113
Target Start/End: Original strand, 34916925 - 34917004
Alignment:
Q |
34 |
actcttctacaagaatatatcaagagcttgaacttagacaaaaatcccccaaaagagtatacaagaaaatcttcaactaa |
113 |
Q |
|
|
|||||||||||| |||||||||||||||| ||| ||||| ||||||| || ||||| |||| ||||||| ||||| |||| |
|
|
T |
34916925 |
actcttctacaaaaatatatcaagagcttaaacctagacgaaaatcctccgaaagattatagaagaaaaccttcagctaa |
34917004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2119 times since January 2019
Visitors: 6159