View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0865_low_5 (Length: 476)
Name: NF0865_low_5
Description: NF0865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0865_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 105; Significance: 3e-52; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 276 - 388
Target Start/End: Original strand, 33079973 - 33080085
Alignment:
| Q |
276 |
gaaaaacagaggaatttgatatcttcagtgtgttcagtagagtagtataaatctgaattgaaattaagaaagaaagaaagtttgttattagatttggata |
375 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33079973 |
gaaaaacagagcaatttgatatcttcagtgtgttcagtagagtagtataaatctgaattgaaattaagaaagaaataaagtttgttattagatttggata |
33080072 |
T |
 |
| Q |
376 |
ttgtttgtgatga |
388 |
Q |
| |
|
||||||||||||| |
|
|
| T |
33080073 |
ttgtttgtgatga |
33080085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 51 - 126
Target Start/End: Original strand, 33079747 - 33079822
Alignment:
| Q |
51 |
accggtttcaacgtgtcatgtagttatttgcatcggtatctgtgtttgtgattcatagtttatagtttattttcct |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33079747 |
accggtttcaacgtgtcatgtagttatttgcatcggtatctgtgtttgtgattcatagtttatagtttattttcct |
33079822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 33079717 - 33079675
Alignment:
| Q |
1 |
taaattgaatgtaatcacatgtgtcggacacgaacaaacatgt |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33079717 |
taaattgaatgtaatcacatgtgtcggacacgaacgaacatgt |
33079675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University