View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0865_low_53 (Length: 255)
Name: NF0865_low_53
Description: NF0865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0865_low_53 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 10 - 213
Target Start/End: Original strand, 45122107 - 45122310
Alignment:
| Q |
10 |
aagaatatgaacttgattcaatgtccaacatttcagctttaccaagcctatcccacaaactaatttcagtttgctcgggaagctgatcaatttttgcatc |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45122107 |
aagaaaatgaacttgattcaatgtccaacatttcagctttaccaagcctgtcccacaaactaatttcagtttgctcgggaagctgatcaatttttgcatc |
45122206 |
T |
 |
| Q |
110 |
ctctgcagattctctaagactaaaaataatttaaatcagttatcaacaactttagaaagcatattgaatccatgacaaaacattatgacatctcttgtta |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45122207 |
ctctgcagattctctaagactataaataatttaaatcagttatcaacaactttagaaagcatattgaatccatgacaaaacattatgacatctcttgtta |
45122306 |
T |
 |
| Q |
210 |
cagc |
213 |
Q |
| |
|
|||| |
|
|
| T |
45122307 |
cagc |
45122310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 21 - 76
Target Start/End: Original strand, 40258211 - 40258266
Alignment:
| Q |
21 |
cttgattcaatgtccaacatttcagctttaccaagcctatcccacaaactaatttc |
76 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
40258211 |
cttgattcaacatccaacatttcagctttaccaagcctctcccacaagctaatttc |
40258266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University