View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0865_low_56 (Length: 250)
Name: NF0865_low_56
Description: NF0865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0865_low_56 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 9 - 246
Target Start/End: Original strand, 27375240 - 27375474
Alignment:
Q |
9 |
caacaaaatgtcccaccaactaaataattagttaacaccatttttgcttaaagtaaaaatcaataaattcttagcttataagtaggctaagtcaaatgtt |
108 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27375240 |
caacaaaatgtcccaccaactaaataattagttaacaccatttttgcttaaagtaaaa-tcaataaattcttagcttataagtaggctaagtcaaatgtt |
27375338 |
T |
 |
Q |
109 |
ggtaaccatatttttcaatagtgataatgatgtttagctatctgagttatctagatattcttatcatttactgttttgcatgtagacannnnnnnnnnnn |
208 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
27375339 |
ggtaaccatatttttcaatagtgatagtgatgtttagctaactgagttatctagatattcttatcatttactgttttgtatgtagaca--tttttttttt |
27375436 |
T |
 |
Q |
209 |
ggtagacacatgtaaacattattatcatcttagtataa |
246 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
27375437 |
ggtagacacatgtaaacattattatcatcttagtataa |
27375474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University