View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0865_low_62 (Length: 220)
Name: NF0865_low_62
Description: NF0865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0865_low_62 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 42805645 - 42805584
Alignment:
Q |
1 |
cacatctaactaaattttcaaactaatatataatatcatgagatgaagacagacacaggttc |
62 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
T |
42805645 |
cacatctaactaaattttcaaactgatatataatatcatgagatgaagacagacacaagttc |
42805584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University