View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0865_low_66 (Length: 213)

Name: NF0865_low_66
Description: NF0865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0865_low_66
NF0865_low_66
[»] chr8 (1 HSPs)
chr8 (1-62)||(42805584-42805645)


Alignment Details
Target: chr8 (Bit Score: 54; Significance: 3e-22; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 42805645 - 42805584
Alignment:
1 cacatctaactaaattttcaaactaatatataatatcatgagatgaagacagacacaggttc 62  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
42805645 cacatctaactaaattttcaaactgatatataatatcatgagatgaagacagacacaagttc 42805584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University