View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0865_low_71 (Length: 209)
Name: NF0865_low_71
Description: NF0865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0865_low_71 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 23 - 179
Target Start/End: Complemental strand, 43965895 - 43965739
Alignment:
| Q |
23 |
aatacatctttcttcttcaatcaaagttcatacaaatgcaaactctgggagaaaagcattgattcatttctgttttcggtttcaatcaggaaccaagaaa |
122 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43965895 |
aatacatctttcctcttcaaccaaagttcatacaaatgcaaactctgggagaaaagcattgattcatttctgttttcggtttcaatcaggaaccaagaaa |
43965796 |
T |
|
| Q |
123 |
atgccgacgtacaagatcagaggaatcgacgttgattttccctatgaagcctatgat |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43965795 |
atgccgacgtacaagatcagaggaatcgacgttgattttccctatgaagcctatgat |
43965739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1467 times since January 2019
Visitors: 6143