View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0866_high_15 (Length: 267)
Name: NF0866_high_15
Description: NF0866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0866_high_15 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 56 - 267
Target Start/End: Complemental strand, 13298160 - 13297949
Alignment:
Q |
56 |
atatttatttattggcttaattaatcaccatttagtagttgcagtgacaagagatcttccatgctccagtagttagaacaacctgattgatcagagattg |
155 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13298160 |
atatatatttattggcttaattaatcaccatttagtagttgaagtgacaagagatcttccatgctccagtagttagaacaacctgattgatcagagattg |
13298061 |
T |
 |
Q |
156 |
tagggaactgatgatgaggtggaaatggttccaaaattccttggtaagagggtggtgagataatgtttgtgtccataggttcagcaatgttggaaatttg |
255 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
13298060 |
tagggaactgatgatgaggtggaaatggttccaaaattccttggtaagagggtggtgatataatatttgtgtccataggttcagcaatgttggaaatttg |
13297961 |
T |
 |
Q |
256 |
gcttgtgcttcc |
267 |
Q |
|
|
|||||||||||| |
|
|
T |
13297960 |
gcttgtgcttcc |
13297949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3177 times since January 2019
Visitors: 6172