View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0866_high_18 (Length: 251)
Name: NF0866_high_18
Description: NF0866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0866_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 21 - 241
Target Start/End: Original strand, 29052380 - 29052599
Alignment:
Q |
21 |
catcatcacctacttccactctttctcttcattcatatggcaaagaatctttctaaataataacacaaagattccaaaacacacacacttctttcactat |
120 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29052380 |
catcatcacctacttccactctttctcttcattcatatggcaaagaatctttctaaataataacacaaagattccaaaacacacacacttctttcactat |
29052479 |
T |
 |
Q |
121 |
aattgttcattgnnnnnnnnnatctttccatcaagaaatgaatttgaatcactcttgtggtttttctttaaccaaacatacnnnnnnnncatcattaact |
220 |
Q |
|
|
|||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
29052480 |
aattgttcgttg-ttttttttatctttccatcaagaaatgaatttgaatcactcttgtggtttttctttaaccaaacatacaagaaaaacatcattaact |
29052578 |
T |
 |
Q |
221 |
tcttctattttccttagaaac |
241 |
Q |
|
|
|||||||||| |||||||||| |
|
|
T |
29052579 |
tcttctatttaccttagaaac |
29052599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3730 times since January 2019
Visitors: 6175