View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0866_high_22 (Length: 204)
Name: NF0866_high_22
Description: NF0866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0866_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 45306666 - 45306772
Alignment:
Q |
1 |
tccttttccaaaatccatttttcctcttaattcaccttcttgttttactt-aaatttttatgcgtaattgctaattttatttgttaatttgattgtgtag |
99 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
45306666 |
tccttttccaaaatccatttttcctcttaattcaccttcttgttttacttaaaaattttatgcgtaattgctaattttatttgttaatttgattatgtag |
45306765 |
T |
 |
Q |
100 |
gatgatg |
106 |
Q |
|
|
||||||| |
|
|
T |
45306766 |
gatgatg |
45306772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3703 times since January 2019
Visitors: 6174