View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0866_high_22 (Length: 204)

Name: NF0866_high_22
Description: NF0866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0866_high_22
NF0866_high_22
[»] chr4 (1 HSPs)
chr4 (1-106)||(45306666-45306772)


Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 45306666 - 45306772
Alignment:
1 tccttttccaaaatccatttttcctcttaattcaccttcttgttttactt-aaatttttatgcgtaattgctaattttatttgttaatttgattgtgtag 99  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |||||    
45306666 tccttttccaaaatccatttttcctcttaattcaccttcttgttttacttaaaaattttatgcgtaattgctaattttatttgttaatttgattatgtag 45306765  T
100 gatgatg 106  Q
    |||||||    
45306766 gatgatg 45306772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3703 times since January 2019
Visitors: 6174