View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0866_low_2 (Length: 486)
Name: NF0866_low_2
Description: NF0866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0866_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 395; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 395; E-Value: 0
Query Start/End: Original strand, 1 - 395
Target Start/End: Original strand, 13212420 - 13212814
Alignment:
Q |
1 |
attcactggtgtttcttcatcttctaaaggtagcctttcataagcagcatttccaaaggaagctgccatgataacaaccggaccggaagctaacaacggt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13212420 |
attcactggtgtttcttcatcttctaaaggtagcctttcataagcagcatttccaaaggaagctgccatgataacaaccggaccggaagctaacaacggt |
13212519 |
T |
 |
Q |
101 |
cccaccacgctaccaccgacgacctgtccttgtccaccagctagatatatggctaatcctgacgccgctggtggagcaggcggcggcaggaaagagccag |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13212520 |
cccaccacgctaccaccgacgacctgtccttgtccaccagctagatatatggctaatcctgacgccgctggtggagcaggcggcggcaggaaagagccag |
13212619 |
T |
 |
Q |
201 |
ataatgataatatctcaaatcttccatgaagtgtgactaccgcaccaggcgatgctggttgacggagagtcacgtttgtgacggtcccacttccgctaag |
300 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13212620 |
ataatgataatatctcaaatcttccatgaagtgtgactaccgcaccaggcgatgctggttgacggagagtcacgtttgtgacggtcccacttccgctaag |
13212719 |
T |
 |
Q |
301 |
gatgcagacaccacgctgcctccttcgcgcaaagaccgtcacactttccatgatgtcacatccatttgcaacttccatcacgtgggatcggagtg |
395 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13212720 |
gatgcagacaccacgctgcctccttcgcgcaaagaccgtcacactttccatgatgtcacatccatttgcaacttccatcacgtgggatcggagtg |
13212814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2326 times since January 2019
Visitors: 6161