View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0866_low_20 (Length: 320)

Name: NF0866_low_20
Description: NF0866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0866_low_20
NF0866_low_20
[»] chr2 (1 HSPs)
chr2 (78-226)||(3109839-3109988)


Alignment Details
Target: chr2 (Bit Score: 134; Significance: 1e-69; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 78 - 226
Target Start/End: Original strand, 3109839 - 3109988
Alignment:
78 attatactatcttgcatcaaattctagaaatgttagtatattagttgttaccatagttt-cggtattcgaacgaatatttattccggtgtcccttagctt 176  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || |||||||||||||||||||    
3109839 attatactatcttgcatcaaattctagaaatgttagtatattagttgttaccatagttttcggtattcgaacgaatactttttccggtgtcccttagctt 3109938  T
177 accaaccgagctgcttacttgggacgcagatttttgtagtagaggtttat 226  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
3109939 accaaccgagctgcttacttgggacgcagatttttgtagtagaggtttat 3109988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University