View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0866_low_20 (Length: 320)
Name: NF0866_low_20
Description: NF0866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0866_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 1e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 78 - 226
Target Start/End: Original strand, 3109839 - 3109988
Alignment:
Q |
78 |
attatactatcttgcatcaaattctagaaatgttagtatattagttgttaccatagttt-cggtattcgaacgaatatttattccggtgtcccttagctt |
176 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||| |
|
|
T |
3109839 |
attatactatcttgcatcaaattctagaaatgttagtatattagttgttaccatagttttcggtattcgaacgaatactttttccggtgtcccttagctt |
3109938 |
T |
 |
Q |
177 |
accaaccgagctgcttacttgggacgcagatttttgtagtagaggtttat |
226 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3109939 |
accaaccgagctgcttacttgggacgcagatttttgtagtagaggtttat |
3109988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University