View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0866_low_24 (Length: 312)
Name: NF0866_low_24
Description: NF0866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0866_low_24 |
 |  |
|
[»] scaffold0598 (2 HSPs) |
 |  |  |
|
[»] scaffold0387 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0598 (Bit Score: 104; Significance: 7e-52; HSPs: 2)
Name: scaffold0598
Description:
Target: scaffold0598; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 65 - 172
Target Start/End: Complemental strand, 4488 - 4381
Alignment:
Q |
65 |
agggttatgatgttcaacgggtctattgatgtttaatctgcacatattatttatgattgattttagaaaacaagtaaatgcagatattttggaagtgatt |
164 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4488 |
agggttatgatgttcaacgggtctattgatgtttaatctgcacatatgatttatgattgattttagaaaacaagtaaatgcagatattttggaagtgatt |
4389 |
T |
 |
Q |
165 |
atattttt |
172 |
Q |
|
|
|||||||| |
|
|
T |
4388 |
atattttt |
4381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0598; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 206 - 239
Target Start/End: Complemental strand, 4316 - 4283
Alignment:
Q |
206 |
gtcgggaatgaaacaacatttttatttgatgatg |
239 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |
|
|
T |
4316 |
gtcgggaatgaaacaacatttttatttgatgatg |
4283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 65 - 171
Target Start/End: Complemental strand, 34467860 - 34467755
Alignment:
Q |
65 |
agggttatgatgttcaacgggtctattgatgtttaatctgcacatattatttatgattgattttagaaaacaagtaaatgcagatattttggaagtgatt |
164 |
Q |
|
|
|||| |||| |||||||||||| |||| ||||||||||| |||| ||| |||||| ||||||||||||||||| ||||||| ||| | | |||||| |
|
|
T |
34467860 |
agggctatgttgttcaacgggttcattgggttttaatctgcatatatgattgatgattt-ttttagaaaacaagtaagtgcagatttttagaaggtgatt |
34467762 |
T |
 |
Q |
165 |
atatttt |
171 |
Q |
|
|
||||||| |
|
|
T |
34467761 |
atatttt |
34467755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 65 - 172
Target Start/End: Complemental strand, 41439435 - 41439332
Alignment:
Q |
65 |
agggttatgatgttcaacgggtctattgatgtttaatctgcacatattatttatgattgattttagaaaacaagtaaatgcagatattttggaagtgatt |
164 |
Q |
|
|
||||||||| |||||||||||| |||| | ||||||||||| |||| ||| |||||| |||||||| |||||| ||||||| ||| | | |||||| |
|
|
T |
41439435 |
agggttatgttgttcaacgggttcattggtttttaatctgcatatatgattgatgatt----ttagaaaataagtaagtgcagatttttagaaggtgatt |
41439340 |
T |
 |
Q |
165 |
atattttt |
172 |
Q |
|
|
|||||||| |
|
|
T |
41439339 |
atattttt |
41439332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 65 - 172
Target Start/End: Complemental strand, 20442309 - 20442206
Alignment:
Q |
65 |
agggttatgatgttcaacgggtctattgatgtttaatctgcacatattatttatgattgattttagaaaacaagtaaatgcagatattttggaagtgatt |
164 |
Q |
|
|
||||||||| |||||| ||||| |||| | ||||||||||| |||| ||| |||||| |||||||| |||||| ||||||| ||| | | |||||| |
|
|
T |
20442309 |
agggttatgttgttcaccgggttcattggtttttaatctgcatatatgattgatgatt----ttagaaaataagtaagtgcagatttttagaaggtgatt |
20442214 |
T |
 |
Q |
165 |
atattttt |
172 |
Q |
|
|
|||||||| |
|
|
T |
20442213 |
atattttt |
20442206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0387 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0387
Description:
Target: scaffold0387; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 65 - 172
Target Start/End: Original strand, 3672 - 3775
Alignment:
Q |
65 |
agggttatgatgttcaacgggtctattgatgtttaatctgcacatattatttatgattgattttagaaaacaagtaaatgcagatattttggaagtgatt |
164 |
Q |
|
|
||||| ||| |||||||| ||| |||| | |||||||||||||||| ||| ||||| ||||||||| |||||||||||||| ||| | | || ||| |
|
|
T |
3672 |
agggtgatgttgttcaacaggttcattggtttttaatctgcacatatgattgatgat----tttagaaaataagtaaatgcagatttttcgaaggttatt |
3767 |
T |
 |
Q |
165 |
atattttt |
172 |
Q |
|
|
|||||||| |
|
|
T |
3768 |
atattttt |
3775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 65 - 172
Target Start/End: Original strand, 16288289 - 16288392
Alignment:
Q |
65 |
agggttatgatgttcaacgggtctattgatgtttaatctgcacatattatttatgattgattttagaaaacaagtaaatgcagatattttggaagtgatt |
164 |
Q |
|
|
||||||||| |||||||||||| ||| | ||||||||||| |||| ||| ||||| ||||||||| |||||| ||||||| ||| | | |||||| |
|
|
T |
16288289 |
agggttatgttgttcaacgggttcatttgtttttaatctgcatatatgattgatgat----tttagaaaataagtaagtgcagatttttagaaggtgatt |
16288384 |
T |
 |
Q |
165 |
atattttt |
172 |
Q |
|
|
|||||||| |
|
|
T |
16288385 |
atattttt |
16288392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1448 times since January 2019
Visitors: 6143