View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0866_low_26 (Length: 309)
Name: NF0866_low_26
Description: NF0866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0866_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 282
Target Start/End: Original strand, 4985803 - 4986084
Alignment:
Q |
1 |
aataaaattgaaaactgagaagatattttattcttgattgtgtatcaaaatttgtttaaattgcggcacaaactcttgtaattttaatgtaaatatagga |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4985803 |
aataaaattgaaaactgagaagatattttattcttgattgtatatcaaaatttgtttaaattgcggcacaaactcttgtaattttaatgtaaatatagga |
4985902 |
T |
 |
Q |
101 |
cactacttgccgacagttgaaaattttgagctccaaagtctcaatcaaatttcaaacctaactgttgacaatgagctttgtaggtgagattccttgagat |
200 |
Q |
|
|
||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
T |
4985903 |
cactacttgccgaaagtagaaaattttgagctccaaagtctcaatcaaatttcaaacctaactgttgacaatgaactttgtcggtgagattccttgagat |
4986002 |
T |
 |
Q |
201 |
tatggcaactgttatgtcataaaaaaggtttnnnnnnntaacagtctcatttttaaggttagtgtgtcttaccatatttttg |
282 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4986003 |
tatggcaactgttatgtcataaaaaaggtttaaaaaaataacagtctcatttttaaggttagtgtgtcttaccatatttttg |
4986084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University