View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0866_low_27 (Length: 305)
Name: NF0866_low_27
Description: NF0866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0866_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 83 - 241
Target Start/End: Complemental strand, 27426171 - 27426013
Alignment:
| Q |
83 |
aaaaacgtagaagagctgcttgagtagttgaattcattctcattaaacaaaacatatttacaatttgccaatctaatggtcatttccttctcatctttta |
182 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27426171 |
aaaaacgtaaaagagctgcttgagtagttgaattcattctcattaaacaaaacatatttacaatttgctaatctaatggtcatttccttctcatctttta |
27426072 |
T |
 |
| Q |
183 |
gaatttgatgagataactagaatacnnnnnnntatttctactaaactatgtcagtctgt |
241 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27426071 |
gaatttgatgagataactagaatacaaaaaaatatttctactaaactatgtcagtctgt |
27426013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 83 - 167
Target Start/End: Original strand, 27565730 - 27565814
Alignment:
| Q |
83 |
aaaaacgtagaagagctgcttgagtagttgaattcattctcattaaacaaaacatatttacaatttgccaatctaatggtcattt |
167 |
Q |
| |
|
|||||| |||||||||||||||| |||| ||||||||| || |||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
27565730 |
aaaaacatagaagagctgcttgaatagtcgaattcattgtcgttaaacaaaattgatatacaatttatcaatctaatggtcattt |
27565814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University