View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0866_low_29 (Length: 280)
Name: NF0866_low_29
Description: NF0866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0866_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 3 - 219
Target Start/End: Original strand, 38982785 - 38983001
Alignment:
| Q |
3 |
ggatagagacactcttaagagcaacttcagtacagggttagagattgactctaaaactatgcacatagactttttgtcactggttagagaagaatgagag |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38982785 |
ggatagagacactcttaagagcaacttcagtacagggttagagattgactctaaaactatgcacatagactttttgtcactggttagagtagaatgagag |
38982884 |
T |
|
| Q |
103 |
tttgttaatgtcatggccataagactttgcacatttgtcagattgttattactaagcaagctgcccctatgaaccatggtatctgaaagataattagcaa |
202 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38982885 |
tttgttaatgtcatggtcataagactttgcacatttgtcagattgttattactaagcaagctgcccctatgaaccatggtatctgaaagataattagcaa |
38982984 |
T |
|
| Q |
203 |
ctgtcgtctcactgcat |
219 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38982985 |
ctgtcgtctcactgcat |
38983001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 41 - 152
Target Start/End: Complemental strand, 39909478 - 39909361
Alignment:
| Q |
41 |
tagagattgactctaaaactatgcac----atagactttttgtcactggttagagaagaatgaga--gtttgttaatgtcatggccataagactttgcac |
134 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||| ||||||||||||||||| |
|
|
| T |
39909478 |
tagagattgactctaaaactatgcatgcatatagactttttgtcactggttagagaagaatgagatagtttgttaatgccatagccataagactttgcac |
39909379 |
T |
|
| Q |
135 |
atttgtcagattgttatt |
152 |
Q |
| |
|
||||||||| |||||||| |
|
|
| T |
39909378 |
atttgtcaggttgttatt |
39909361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 213 - 254
Target Start/End: Complemental strand, 38979924 - 38979883
Alignment:
| Q |
213 |
actgcattcatggaaatacaaatcaataagataaccagttgt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38979924 |
actgcattcatggaaatacaaatcaataagataaccagttgt |
38979883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 213 - 254
Target Start/End: Original strand, 39910545 - 39910586
Alignment:
| Q |
213 |
actgcattcatggaaatacaaatcaataagataaccagttgt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39910545 |
actgcattcatggaaatacaaatcaataagataacctgttgt |
39910586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 213 - 249
Target Start/End: Original strand, 39856982 - 39857018
Alignment:
| Q |
213 |
actgcattcatggaaatacaaatcaataagataacca |
249 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
39856982 |
actgcattcatggaaaaacaaatcaataagaaaacca |
39857018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2304 times since January 2019
Visitors: 6161