View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0866_low_30 (Length: 279)
Name: NF0866_low_30
Description: NF0866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0866_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 52 - 127
Target Start/End: Original strand, 33153020 - 33153095
Alignment:
| Q |
52 |
tcatcagcatcaacaacaccatcaacaccgtcactatgcccattcgctaccccaaaaactcgatcttcctcgccac |
127 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||| | |||||||||||||||||||||||||||| |
|
|
| T |
33153020 |
tcatcagcatcaacaacaccatcaacaccttcactatggccattctccaccccaaaaactcgatcttcctcgccac |
33153095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3630 times since January 2019
Visitors: 6174