View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0867_high_13 (Length: 391)
Name: NF0867_high_13
Description: NF0867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0867_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 23 - 387
Target Start/End: Complemental strand, 33816001 - 33815658
Alignment:
| Q |
23 |
cttaattaacttatctttcttcccttattatctatatttatacatttgatcatgaaattataagatggtattgtatcgatctaatctctccattgttcac |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33816001 |
cttaattaacttatctttcttcccttattatctatctttatacatttgatcatgaaattataa---------------------tctctccattgttcac |
33815923 |
T |
|
| Q |
123 |
attatgaaatgattcttgaaattgtaagatgataattgttacagaccggctacaaggcccagtcggtcaaagcctaataaatactagctcacaacggcga |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
33815922 |
attatgaaatgattcttgaaattgtaagatgataattgttacagaccggctacaaggcccagtcagtcaaagcctaataaagactagctcacaacggcga |
33815823 |
T |
|
| Q |
223 |
tggaacaggctaaactccgtgtgaggtaccacactaaagcgtgtctcaggtccatctgagttgttgaagccatctcaaaccacctcatggagaggcgtcg |
322 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||| |||||||||||| ||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
33815822 |
tggaacaggctaaactccgtgtgaggcaccacacaaaagcgtgtctcgggtccatctgagctgttgaagccatctctaaccacctcatggagagacgtcg |
33815723 |
T |
|
| Q |
323 |
tgcatttaacgaagacggttatgttcttacacgcttatataaggatgacttaacgtcacccctaa |
387 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
33815722 |
tgcatttcacgaagacggttatgttcttacacgcttatataaggatgatttaacatcacccctaa |
33815658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3490 times since January 2019
Visitors: 6174