View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0867_high_30 (Length: 251)
Name: NF0867_high_30
Description: NF0867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0867_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 43410645 - 43410405
Alignment:
Q |
1 |
catacaaagcatgccagttatgcacatgtgcattatatgcacttaagcagctagcttgtatttgctatgaggtttggttctgatggtttcttggaagatt |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43410645 |
catacaaagcatgccagttatgcacatgtgcattatatgcacttatgcagctagcttgtatttgctatgaggtttggttctgatggtttcttggaagatt |
43410546 |
T |
 |
Q |
101 |
tgctttctaccttgccaactaacctatgatgatgataattatatttgcagtttgaaggactacgccgtgatagtttttcttagttattttaggatgttta |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43410545 |
tgctttctaccttgccaactaacctatgatgatgataattatatttgcagtttgaaggactacgccgtgatagtttttcttagttattttaggatgttta |
43410446 |
T |
 |
Q |
201 |
atttgcttcgcataaatgtatcattcctcgtatcagaatta |
241 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
43410445 |
atttgcttcgcataaacgtatcattcctcgtatcagaatta |
43410405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University