View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0867_low_10 (Length: 442)
Name: NF0867_low_10
Description: NF0867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0867_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 159 - 409
Target Start/End: Original strand, 48486801 - 48487053
Alignment:
| Q |
159 |
tgcccctggaatctgaacaagattattcttaatatgagcgaatacaagccaaatattcttgcaggcagaacaacaaccaaaatcaca--cacaaacacaa |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48486801 |
tgcccctggaatctgaacaagattattcttaatatgagcgagtacaagccaaatattcttgcaggcagaacaacaaccaaaatcacacacacaaacacaa |
48486900 |
T |
|
| Q |
257 |
acctatccatgaattccaagaaggggaataccatcccctgcttcgcccatgcatagtcctgccaagtgcccatcacaaattcattagatttcaacaataa |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48486901 |
acctatccatgaattccaagaaggggaataccatcccctgcttcgcccatgcatagtcctgccaagtgcccatcacaaattcattagatttcaacaataa |
48487000 |
T |
|
| Q |
357 |
caacaactcaaacctttacataaaggtgtgttgagaagagcttaccctatgct |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48487001 |
caacaactcaaacctttacataaaggtgtgttgagaagagcttaccctgtgct |
48487053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1670 times since January 2019
Visitors: 6148