View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0867_low_17 (Length: 351)
Name: NF0867_low_17
Description: NF0867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0867_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 186 - 341
Target Start/End: Original strand, 41415133 - 41415288
Alignment:
Q |
186 |
gcacccttcaaactatttgatacttgtttgactaatctaaagataggttttaaattggaaacaaagtttccttctttcatagaaaaaatttacttgtgtt |
285 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41415133 |
gcacccttcaaactatttgatacttgtttgactaatctaaagataggttttaaattggaaacaaagtttccttctttcatagaaaaaatttacttgtgtt |
41415232 |
T |
 |
Q |
286 |
ctaaaccaataaaggaaaaaatgttttatctgctaagtattgaccatctattcatc |
341 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
41415233 |
ctaaaccaataaaggaaaaaatgttttatctgctaagtattgaccatcaattcatc |
41415288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 30 - 125
Target Start/End: Original strand, 41414976 - 41415071
Alignment:
Q |
30 |
catctctgacaaataaagcggaattgccttcnnnnnnngcatgagggggaacatcgcaaaatatttgtcaactttcaaggtataacttaaacatac |
125 |
Q |
|
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
41414976 |
catctctgacaaataaagcggaattgccttcaaaaaaagcatgagggggaacatcgcaaaatatttgtcaactttcaaggtataactcaaacatac |
41415071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1741 times since January 2019
Visitors: 6149