View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0867_low_21 (Length: 317)
Name: NF0867_low_21
Description: NF0867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0867_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 43410668 - 43410890
Alignment:
Q |
1 |
ttctcaaggtttctcttgttatgccaactcaccaccacttcaaaatctctaggagaaaaagaaccgtacctttctgcattatgaatttctatatccttgt |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
43410668 |
ttctcaaggtttctcttgttatgccaactcaccaccacttcaaaatctctaggagaaaaagaaccgtacctttttgcattatgaatttctatatccttgt |
43410767 |
T |
 |
Q |
101 |
tgctgaggctggagttttcatctggatggttattgttatagttaggaattggtacattgcagatgaatggtgacaaaagtggatcaggtatcgattcttg |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43410768 |
tgctgaggctggagttttcatctggatggttattgttatagttaggaattggtacattgcagatgaatggtgacaaaagtggatcaggtatcgattcttg |
43410867 |
T |
 |
Q |
201 |
tttgtttcccctagcagctagtt |
223 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
43410868 |
tttgtttcccctagcagctagtt |
43410890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University