View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0867_low_25 (Length: 284)
Name: NF0867_low_25
Description: NF0867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0867_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 14 - 164
Target Start/End: Complemental strand, 54636873 - 54636723
Alignment:
Q |
14 |
acatcatcatttcatgctccatatcatcattcaagttaataccctcgatcacaacatcaccttgaatatggcaattgatatcaattttaattagttcgca |
113 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54636873 |
acatcatcatttcatgctccatatcatcattcaagttaataccctcgatcacaacatcaccttgaatatggcaattgatatcaattttaattagttcgca |
54636774 |
T |
 |
Q |
114 |
ctctccctgcaatacagtagcaaggaattccatgataattacacaattcag |
164 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54636773 |
ctctccctgcaatacagtagcaaggaattccatgataattacacaattcag |
54636723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1047 times since January 2019
Visitors: 6135