View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0867_low_30 (Length: 259)
Name: NF0867_low_30
Description: NF0867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0867_low_30 |
 |  |
|
| [»] chr6 (9 HSPs) |
 |  |
|
| [»] chr8 (5 HSPs) |
 |  |
|
| [»] chr4 (10 HSPs) |
 |  |
|
| [»] chr5 (10 HSPs) |
 |  |
|
| [»] chr2 (5 HSPs) |
 |  |
|
| [»] chr1 (8 HSPs) |
 |  |
|
| [»] chr3 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 9)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 61 - 259
Target Start/End: Complemental strand, 30487699 - 30487501
Alignment:
| Q |
61 |
ggattctcttcttcattctccatgggaagtcaagaaactttatggctatcagaaccatgaatttcagtttcattgtcatgtccaaatccaggtggggaac |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30487699 |
ggattctcttcttcattctccatgggaagtcaagaaactttatggctatcagaaccatgaatttcagtttcattgtcatgtccaaatccaggtggggaac |
30487600 |
T |
 |
| Q |
161 |
ctgtcccaaagattaatatgctaccacgtggtggctgagagtaacacatgctagtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30487599 |
ctgtcccaaagattattatgctactacgtggtggctgagagtaacacatgctagtgtgtttcgattgagggtttaggaggggaagggagtggagggttt |
30487501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 214 - 259
Target Start/End: Original strand, 14515476 - 14515521
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
14515476 |
gtgtgtttggattgagggtttaggaggggaagggaggggagggttt |
14515521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 213 - 259
Target Start/End: Complemental strand, 19278279 - 19278233
Alignment:
| Q |
213 |
agtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
||||||||| ||||||| ||||| ||||||||||||| ||||||||| |
|
|
| T |
19278279 |
agtgtgtttggattgagagtttaggaggggaagggaggggagggttt |
19278233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 213 - 259
Target Start/End: Original strand, 31849112 - 31849158
Alignment:
| Q |
213 |
agtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
31849112 |
agtgtgttaggattgagggtttaagaggggaagggaggggagggttt |
31849158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 213 - 258
Target Start/End: Complemental strand, 4097755 - 4097710
Alignment:
| Q |
213 |
agtgtgtttcgattgagggtttatgaggggaagggagtggagggtt |
258 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||| | |||||| |
|
|
| T |
4097755 |
agtgtgtttggattgagggtttaagaggggaagggagggaagggtt |
4097710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 214 - 255
Target Start/End: Original strand, 9719034 - 9719075
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagg |
255 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| ||||| |
|
|
| T |
9719034 |
gtgtgtttggattgagggtttaggaggggaagggaggggagg |
9719075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 214 - 259
Target Start/End: Complemental strand, 9719271 - 9719226
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||| || |||||| |
|
|
| T |
9719271 |
gtgtgtttggattgagggtttatgaggggaagagaggggtgggttt |
9719226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 214 - 259
Target Start/End: Original strand, 9721141 - 9721186
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| |||||| |||||| ||||||||||||| ||||||||| |
|
|
| T |
9721141 |
gtgtgtttggattgaaggtttaggaggggaagggaggggagggttt |
9721186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 214 - 258
Target Start/End: Original strand, 30487309 - 30487353
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggtt |
258 |
Q |
| |
|
|||||||| ||| ||||||||| ||||||||||||| |||||||| |
|
|
| T |
30487309 |
gtgtgtttggatggagggtttaggaggggaagggaggggagggtt |
30487353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 214 - 259
Target Start/End: Complemental strand, 31543313 - 31543268
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
31543313 |
gtgtgtttcgattgagggtttaggaggggaagggaggggagggttt |
31543268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 214 - 259
Target Start/End: Complemental strand, 30479958 - 30479913
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| ||||||||||||||||| |||| |||| ||||||||| |
|
|
| T |
30479958 |
gtgtgtttggattgagggtttatgagaggaatggagcggagggttt |
30479913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 214 - 255
Target Start/End: Original strand, 43732682 - 43732723
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagg |
255 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| ||||| |
|
|
| T |
43732682 |
gtgtgtttggattgagggtttaggaggggaagggagaggagg |
43732723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 214 - 259
Target Start/End: Complemental strand, 43732928 - 43732883
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| ||| ||||||||| ||||||||||||| ||||||||| |
|
|
| T |
43732928 |
gtgtgtttggatggagggtttaggaggggaagggaggggagggttt |
43732883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 214 - 258
Target Start/End: Complemental strand, 8815382 - 8815338
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggtt |
258 |
Q |
| |
|
|||||||| ||||||||||||| |||||| |||||| |||||||| |
|
|
| T |
8815382 |
gtgtgtttggattgagggtttaggagggggagggaggggagggtt |
8815338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 10)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 213 - 259
Target Start/End: Complemental strand, 46007943 - 46007897
Alignment:
| Q |
213 |
agtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
46007943 |
agtgtgtttggattgagggtttaggaggggaagggaggggagggttt |
46007897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 214 - 259
Target Start/End: Complemental strand, 49735733 - 49735688
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
49735733 |
gtgtgtttggattgagggtttaggaggggaagggaggggagggttt |
49735688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 214 - 259
Target Start/End: Complemental strand, 54320675 - 54320630
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
54320675 |
gtgtgtttggattgagggtttaggaggggaagggaggggagggttt |
54320630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 214 - 258
Target Start/End: Complemental strand, 7977738 - 7977694
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggtt |
258 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||| |||||||| |
|
|
| T |
7977738 |
gtgtgtttggattgagggtttatgaggggaaaggaggggagggtt |
7977694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 214 - 258
Target Start/End: Original strand, 49735471 - 49735515
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggtt |
258 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
49735471 |
gtgtgtttggattgagggtttaggaggggaagggaggggagggtt |
49735515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 214 - 258
Target Start/End: Original strand, 56135752 - 56135796
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggtt |
258 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
56135752 |
gtgtgtttggattgagggtttaggaggggaagggaggggagggtt |
56135796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 214 - 259
Target Start/End: Complemental strand, 21695129 - 21695084
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||| || ||||||||| |
|
|
| T |
21695129 |
gtgtgtttggattgggggtttatgaggggaaggaagcggagggttt |
21695084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 214 - 259
Target Start/End: Complemental strand, 31348562 - 31348517
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| ||||||| ||||| ||||||||||||| ||||||||| |
|
|
| T |
31348562 |
gtgtgtttggattgagagtttaggaggggaagggaggggagggttt |
31348517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 214 - 259
Target Start/End: Complemental strand, 37711364 - 37711319
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| ||| ||||||||| ||||||||||||| ||||||||| |
|
|
| T |
37711364 |
gtgtgtttggatggagggtttaggaggggaagggaggggagggttt |
37711319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 214 - 259
Target Start/End: Complemental strand, 54935310 - 54935265
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| ||| ||||||||| ||||||||||||| ||||||||| |
|
|
| T |
54935310 |
gtgtgtttggatggagggtttaggaggggaagggaggggagggttt |
54935265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 7)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 214 - 255
Target Start/End: Original strand, 25887195 - 25887236
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagg |
255 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
25887195 |
gtgtgtttggattgagggtttatgaggggaagggaggggagg |
25887236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 214 - 259
Target Start/End: Complemental strand, 39856106 - 39856061
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
39856106 |
gtgtgtttggattgagggtttaggaggggaagggaggggagggttt |
39856061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 214 - 259
Target Start/End: Original strand, 47390858 - 47390903
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| ||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
47390858 |
gtgtgtttggattgaggggttaggaggggaagggagtggagggttt |
47390903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 214 - 258
Target Start/End: Original strand, 37925844 - 37925888
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggtt |
258 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
37925844 |
gtgtgtttggattgagggtttaggaggggaagggaggggagggtt |
37925888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 256
Target Start/End: Complemental strand, 36267794 - 36267752
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggaggg |
256 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| |||||| |
|
|
| T |
36267794 |
gtgtgtttggattgagggtttaggaggggaagggaggggaggg |
36267752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 217 - 259
Target Start/End: Original strand, 40282203 - 40282245
Alignment:
| Q |
217 |
tgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
40282203 |
tgtttggattgagggtttaggaggggaagggagaggagggttt |
40282245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 212 - 249
Target Start/End: Complemental strand, 31364287 - 31364250
Alignment:
| Q |
212 |
tagtgtgtttcgattgagggtttatgaggggaagggag |
249 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
31364287 |
tagtgtgtttggattgagggtttaggaggggaagggag |
31364250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 10)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 214 - 259
Target Start/End: Original strand, 13634714 - 13634759
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
13634714 |
gtgtgtttggattgagggtttaggaggggaagggaggggagggttt |
13634759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 214 - 259
Target Start/End: Complemental strand, 14245287 - 14245242
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
14245287 |
gtgtgtttggattgagggtttaggaggggaagggaggggagggttt |
14245242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 214 - 259
Target Start/End: Original strand, 16938482 - 16938527
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
16938482 |
gtgtgtttggattgagggtttaggaggggaagggaggggagggttt |
16938527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 215 - 259
Target Start/End: Complemental strand, 2550592 - 2550548
Alignment:
| Q |
215 |
tgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
2550592 |
tgtgtttggattgagggtttaggaggggaagggaggggagggttt |
2550548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 256
Target Start/End: Complemental strand, 13634952 - 13634910
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggaggg |
256 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| |||||| |
|
|
| T |
13634952 |
gtgtgtttggattgagggtttaggaggggaagggaggggaggg |
13634910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 214 - 259
Target Start/End: Complemental strand, 1658054 - 1658009
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| ||| ||||||||| ||||||||||||| ||||||||| |
|
|
| T |
1658054 |
gtgtgtttggatggagggtttaggaggggaagggaggggagggttt |
1658009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 214 - 259
Target Start/End: Complemental strand, 11757144 - 11757099
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| ||| ||||||||| ||||||||||||| ||||||||| |
|
|
| T |
11757144 |
gtgtgtttggatggagggtttaagaggggaagggaggggagggttt |
11757099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 214 - 255
Target Start/End: Original strand, 14245091 - 14245132
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagg |
255 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| ||||| |
|
|
| T |
14245091 |
gtgtgtttggattgagggtttaggaggggaagggaggggagg |
14245132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 214 - 259
Target Start/End: Original strand, 26414896 - 26414941
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| ||||||||||||| |||| |||||||| ||||||||| |
|
|
| T |
26414896 |
gtgtgtttggattgagggtttaggaggagaagggaggggagggttt |
26414941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 216 - 256
Target Start/End: Original strand, 11436944 - 11436984
Alignment:
| Q |
216 |
gtgtttcgattgagggtttatgaggggaagggagtggaggg |
256 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||| |||||| |
|
|
| T |
11436944 |
gtgtttggattgagggtttaggaggggaagggagaggaggg |
11436984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 214 - 259
Target Start/End: Original strand, 17379849 - 17379894
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
17379849 |
gtgtgtttggattgagggtttaggaggggaagggaggggagggttt |
17379894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 214 - 255
Target Start/End: Complemental strand, 36046442 - 36046401
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagg |
255 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
36046442 |
gtgtgtttggattgagggtttatgaggggaagggaggggagg |
36046401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 256
Target Start/End: Original strand, 35736178 - 35736220
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggaggg |
256 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| |||||| |
|
|
| T |
35736178 |
gtgtgtttggattgagggtttaggaggggaagggaggggaggg |
35736220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 214 - 258
Target Start/End: Complemental strand, 22356245 - 22356201
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggtt |
258 |
Q |
| |
|
|||||||| |||||||| |||| ||||||||||||| |||||||| |
|
|
| T |
22356245 |
gtgtgtttggattgaggatttaggaggggaagggaggggagggtt |
22356201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 214 - 258
Target Start/End: Complemental strand, 23748336 - 23748292
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggtt |
258 |
Q |
| |
|
|||||||| ||| ||||||||| ||||||||||||| |||||||| |
|
|
| T |
23748336 |
gtgtgtttggatggagggtttaggaggggaagggaggggagggtt |
23748292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 8)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 214 - 259
Target Start/End: Complemental strand, 35349703 - 35349658
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
35349703 |
gtgtgtttggattaagggtttatgaggggaagggaggggagggttt |
35349658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 256
Target Start/End: Original strand, 26324017 - 26324059
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggaggg |
256 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| |||||| |
|
|
| T |
26324017 |
gtgtgtttggattgagggtttaggaggggaagggaggggaggg |
26324059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 213 - 259
Target Start/End: Complemental strand, 38510136 - 38510090
Alignment:
| Q |
213 |
agtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
||||||||| |||| |||||||| ||||||||||||| ||||||||| |
|
|
| T |
38510136 |
agtgtgtttggattaagggtttaggaggggaagggaggggagggttt |
38510090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 214 - 259
Target Start/End: Complemental strand, 12234251 - 12234206
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| ||| ||||||||| ||||||||||||| ||||||||| |
|
|
| T |
12234251 |
gtgtgtttggatggagggtttaggaggggaagggaggggagggttt |
12234206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 214 - 259
Target Start/End: Complemental strand, 20607458 - 20607413
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| ||| ||||||||| ||||||||||||| ||||||||| |
|
|
| T |
20607458 |
gtgtgtttggatggagggtttaggaggggaagggaggggagggttt |
20607413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 214 - 255
Target Start/End: Original strand, 30010335 - 30010376
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagg |
255 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||| ||||| |
|
|
| T |
30010335 |
gtgtgtttggattgagggtttaggaggggaagggaggggagg |
30010376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 214 - 259
Target Start/End: Original strand, 41498407 - 41498452
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||| ||| ||||||||| |
|
|
| T |
41498407 |
gtgtgtttggattgagggtttaggaggggaagtgaggggagggttt |
41498452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 214 - 258
Target Start/End: Original strand, 38509897 - 38509941
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggtt |
258 |
Q |
| |
|
|||||||| ||| ||||||||| ||||||||||||| |||||||| |
|
|
| T |
38509897 |
gtgtgtttggatagagggtttaggaggggaagggagaggagggtt |
38509941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 214 - 259
Target Start/End: Original strand, 24560220 - 24560265
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| |||| |||||||| ||||||||||||| ||||||||| |
|
|
| T |
24560220 |
gtgtgtttggattaagggtttaggaggggaagggaggggagggttt |
24560265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 214 - 259
Target Start/End: Complemental strand, 41110562 - 41110517
Alignment:
| Q |
214 |
gtgtgtttcgattgagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||| ||| ||||| |
|
|
| T |
41110562 |
gtgtgtttggattgagggtttgtgaggggaagggagaggaaggttt |
41110517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 227 - 259
Target Start/End: Complemental strand, 26136025 - 26135993
Alignment:
| Q |
227 |
gagggtttatgaggggaagggagtggagggttt |
259 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
26136025 |
gagggtttaggaggggaagggagtggagggttt |
26135993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University