View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0867_low_31 (Length: 256)
Name: NF0867_low_31
Description: NF0867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0867_low_31 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
| [»] scaffold0164 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 9e-45; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 135 - 256
Target Start/End: Original strand, 18405090 - 18405210
Alignment:
| Q |
135 |
cacataataagaccctatgacagaggagtactgaaacattctcataaaaataagttaacannnnnnnatgaagggtgattctatgtgaagtaaataaaga |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18405090 |
cacataataagaccctatgacagaggagtactgaaacattctcataaaaataagttaaca-ttttttatgaagggtgattctatgtgaagtaaataaaga |
18405188 |
T |
 |
| Q |
235 |
cattaaaattgtaatgatttaa |
256 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
18405189 |
cattagaattgtaatgatttaa |
18405210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0164 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: scaffold0164
Description:
Target: scaffold0164; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 83 - 136
Target Start/End: Original strand, 33791 - 33844
Alignment:
| Q |
83 |
aaccgtcaaagcacttgcatgccatgaagggtgtaaagtggaattatattttca |
136 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33791 |
aaccgtctaagtacttgcatgccatgaagggtgtaaagtggaattatatattca |
33844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0164; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 57
Target Start/End: Original strand, 33773 - 33801
Alignment:
| Q |
29 |
ggtagcagtttattttgtaaccgtctaag |
57 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33773 |
ggtagcagtttattttgtaaccgtctaag |
33801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University