View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0867_low_37 (Length: 229)
Name: NF0867_low_37
Description: NF0867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0867_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 6 - 135
Target Start/End: Original strand, 12829275 - 12829408
Alignment:
| Q |
6 |
gagatgaaacttttggaatcaaagcaacaaagtacgctaacaaaccttttgggatttcctcattcccataaaattgatcaaac----acaatttggacct |
101 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||| | |||| |
|
|
| T |
12829275 |
gagatgaaacttccggaatcaaagcaacaaaatacgctaacaaaccttttgggatttcctcattcccatgaaattgatcaaacatatataatccgcacct |
12829374 |
T |
 |
| Q |
102 |
catccttgattaaataccaaaattccttcacaaa |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
12829375 |
catccttgattaaataccaaaattccttcacaaa |
12829408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 143 - 179
Target Start/End: Complemental strand, 38325872 - 38325836
Alignment:
| Q |
143 |
ctgttgcgaataaaaccacttatgagagcctccaccc |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38325872 |
ctgttgcgaataaaaccacttatgagagcctccaccc |
38325836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 71 - 131
Target Start/End: Complemental strand, 31052875 - 31052815
Alignment:
| Q |
71 |
ccataaaattgatcaaacacaatttggacctcatccttgattaaataccaaaattccttca |
131 |
Q |
| |
|
||||||||||||||||||| ||| || ||||||| ||| | | ||||||||||||||||| |
|
|
| T |
31052875 |
ccataaaattgatcaaacaaaatgtgaacctcatgcttcaaaagataccaaaattccttca |
31052815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 6 - 115
Target Start/End: Original strand, 31737304 - 31737413
Alignment:
| Q |
6 |
gagatgaaacttttggaatcaaagcaacaaagtacgctaacaaaccttttgggatttcctcattcccataaaattgatcaaacacaatttggacctcatc |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||| |||||||| ||| ||||||| ||| ||||||||||| | ||| |||||||| |
|
|
| T |
31737304 |
gagatgaaacttttggaatcaaagcaacaaaataagctaacatcccttttggtattacctcattagcatggaattgatcaaataaaatcctcacctcatc |
31737403 |
T |
 |
| Q |
106 |
cttgattaaa |
115 |
Q |
| |
|
|||||||||| |
|
|
| T |
31737404 |
cttgattaaa |
31737413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 98 - 135
Target Start/End: Original strand, 8506569 - 8506606
Alignment:
| Q |
98 |
acctcatccttgattaaataccaaaattccttcacaaa |
135 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||| |
|
|
| T |
8506569 |
acctcatccttgatcaagtaccaaaattccttcacaaa |
8506606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 63 - 135
Target Start/End: Original strand, 40197971 - 40198043
Alignment:
| Q |
63 |
cctcattcccataaaattgatcaaacacaatttggacctcatccttgattaaataccaaaattccttcacaaa |
135 |
Q |
| |
|
||||||| |||| |||||| ||||||| |||| |||||||| ||||| || |||||||||||||||||||| |
|
|
| T |
40197971 |
cctcattaccatgaaattggtcaaacataattctcacctcatctttgatcaagtaccaaaattccttcacaaa |
40198043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University