View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0867_low_38 (Length: 217)

Name: NF0867_low_38
Description: NF0867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0867_low_38
NF0867_low_38
[»] chr8 (1 HSPs)
chr8 (1-138)||(3238502-3238639)


Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 3238639 - 3238502
Alignment:
1 ttaagaagaaactgtgctatatatgtatacggtaattctcaatcaattacaggttgatcgagctgtgacactcgccatttctcaaaatgaagggttaccg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3238639 ttaagaagaaactgtgctatatatgtatacggtaattctcaatcaattacaggttgatcgagctgtgacactcgccatttctcaaaatgaagggttaccg 3238540  T
101 tatacatatacagcacagtttcgatcgagctgtgacct 138  Q
    ||||||||||||||||||||||||||||||||||||||    
3238539 tatacatatacagcacagtttcgatcgagctgtgacct 3238502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3454 times since January 2019
Visitors: 6174