View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0869_low_11 (Length: 285)
Name: NF0869_low_11
Description: NF0869
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0869_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 81 - 213
Target Start/End: Original strand, 44692796 - 44692928
Alignment:
| Q |
81 |
gcggtggaatcttcgtaggaggaatgccctccccccggaggtttcggttagatgtgtgttgtgcgaggaggaaatggaaagatctaatcacctttttgtg |
180 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
44692796 |
gcggtggaatcttcgtagaaggaatgccctccccccggaggtttcggttagatgtgtgttgtgcgaggaggaaatggaaatatctaatcacctttttgtg |
44692895 |
T |
 |
| Q |
181 |
cattgtccggtggctagagggatattgttggag |
213 |
Q |
| |
|
||||||||||||||||||||||| | ||||||| |
|
|
| T |
44692896 |
cattgtccggtggctagagggatttggttggag |
44692928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 44692672 - 44692758
Alignment:
| Q |
1 |
gctggattgtggagaataggtggagtgtggaggagttgggagttttttctcaactttggaaaagcccggctccgtcaaaagcggtgg |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44692672 |
gctggattgtggagaataggtggagtgtggaggagttgggagttttttctcaactttggaaaagcccggctccgtcaaaagtggtgg |
44692758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 3 - 87
Target Start/End: Complemental strand, 34866518 - 34866434
Alignment:
| Q |
3 |
tggattgtggagaataggtggagtgtggaggagttgggagttttttctcaactttggaaaagcccggctccgtcaaaagcggtgg |
87 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||| |||| ||| |||||||||||||||||||| || ||||||| ||||| |
|
|
| T |
34866518 |
tggattgtggagaacaattggagtgtggaggagttgagagtgtttctccaactttggaaaagcccggccccctcaaaagtggtgg |
34866434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University